Nuevas funciones de las proteínas Fur en cianobacterias: Contribución a la definición del regulón FurA en Anabaena sp. PCC 7120

González Rodríguez, Andrés
Fillat Castejón, María Francisca (dir.)

Universidad de Zaragoza, 2013

Abstract: En el presente trabajo de tesis nos propusimos avanzar en el conocimiento de la funciones de las proteínas Fur en cianobacterias mediante el estudio del regulón FurA de la cianobacteria filamentosa formadora de heterocistos Anabaena sp. PCC 7120. Como herramienta de trabajo para el estudio del regulón construimos una estirpe de sobreexpresión de FurA en Anabaena sp. PCC 7120, empleando un vector lanzadera con orígenes de replicación en E. coli y Anabaena sp. que logró incrementar hasta ~32 veces el nivel de expresión del metalorregulador. Una vez obtenida la estirpe de sobreexpresión, denominada Anabaena sp. AG2770FurA, se procedió a realizar un análisis fenotípico de la nueva cepa con el objetivo de identificar los posibles cambios morfológicos, fisiológicos y moleculares acontecidos en el microorganismo como consecuencia directa o indirecta de la sobreexpresión del regulador transcripcional. El análisis fenotípico incluyó la evaluación comparativa de la velocidad de crecimiento y el tiempo de duplicación en medio BG11, la concentración de pigmentos fotosintéticos (clorofila a, carotenoides, ficobiliproteínas) y proteínas totales en diferentes fases del crecimiento, así como el estudio por microscopía óptica y electrónica de la morfología celular, la integridad de los filamentos, la autofluorescencia y la ultraestructura de las células. Se evaluó asimismo la actividad fotosintética según la evolución de oxígeno mediante electrodo de Clark y se compararon además actividades enzimáticas tales como catalasa y superóxido-dismutasa, la producción de especies reactivas del oxígeno y la tolerancia a estrés oxidativo tras la exposición a una fuente exógena de peróxido de hidrógeno. Como parte del estudio fenotípico se realizó además un análisis proteómico comparativo entre la estirpe de sobreexpresión y la cepa isogénica parental crecidas bajos las mismas condiciones de cultivo. Sobre la base de los cambios fenotípicos observados se investigó el impacto de la sobreexpresión de FurA sobre la transcripción de una variedad de genes de interés mediante sqRT-PCR. Posteriormente, con el fin de identificar los cambios en la expresión génica directamente mediados por FurA, se analizó mediante retardo en gel (EMSA) la afinidad in vitro de FurA recombinante a cada uno de los promotores de los genes evaluados previamente por sqRT-PCR. La sobreexpresión del metalorregulador en Anabaena sp. indujo múltiples cambios fenotípicos en la cianobacteria como consecuencia de la variación en la expresión de una variedad de genes de categorías funcionales diversas, tanto dianas transcripcionales directas como otros genes. La combinación de estudios fenotípicos, análisis comparativos de la expresión génica y ensayos de afinidad in vitro FurA-DNA condujeron a la identificación inicial de al menos 13 nuevas dianas transcripcionales directas, implicadas en procesos celulares tales como el metabolismo del hierro, las defensas frente el daño oxidativo, la fotosíntesis, la diferenciación a heterocistos, el metabolismo energético, la morfología celular y la replicación del DNA, entre otras. Los resultados demostraban el papel de FurA como regulador global de la transcripción en cianobacterias, de forma similar a lo observado con proteínas Fur de bacterias heterotróficas. Con el objetivo de profundizar en la función de FurA como regulador de la homeostasis del hierro, realizamos adicionalmente un estudio comparativo de la expresión génica de la estirpe de sobreexpresión en condiciones de suficiencia y deficiencia de hierro, prestando especial interés en varios mediadores del metabolismo de este micronutriente esencial en Anabaena sp. PCC 7120. Los resultados obtenidos demostraron el papel de FurA como regulador máster de la homeostasis del hierro en Anabaena sp., modulando la expresión de genes implicados en prácticamente cada etapa del metabolismo del hierro, incluyendo la adquisición, transporte, almacenamiento y consumo del hierro en la célula. Los resultados asociados a este experimento permitieron identificar por primera vez al regulador FurA como un modulador transcripcional dual (represor y activador) en la ruta de biosíntesis de tetrapirroles. La acción activadora de FurA sobre la transcripción de los genes hemK (protoporfirinógeno-oxidasa) y hemH (ferroquelatasa) constituye el primer ejemplo documentado de activación transcripcional directa de una proteína Fur en cianobacterias. La participación de FurA como modulador transcripcional en otros procesos celulares típicos de cianobacterias como la diferenciación celular a heterocistos constituyó un objetivo de especial interés en nuestra investigación. La sobreexpresión del metalorregulador bajo condiciones de deficiencia de nitrógeno combinado en el medio de cultivo condujo al bloqueo parcial del proceso de diferenciación a heterocistos en estadios tempranos del desarrollo. Estudios de afinidad in vitro mediante EMSA y footprinting demostraron que FurA reconoce y se une específicamente al promotor de ntcA, cuyo producto génico actúa como regulador transcripcional global del metabolismo del nitrógeno. La sobreexpresión de FurA afectó sensiblemente el incremento transitorio de NtcA que tiene lugar en las primeras horas del desarrollo del heterocisto y que resulta esencial para la ulterior expresión de una variedad de genes implicados en la cascada regulatoria que define al proceso de diferenciación. Los resultados de nuestras investigaciones y de trabajos previos de nuestro grupo sugieren que la expresión de FurA en el heterocisto está ligada al desarrollo del mismo, es regulada por NtcA y su abundancia en cada momento influye directamente en el normal proceso de diferenciación. FurA parece funcionar como un modulador de la expresión de ntcA, que regula adecuadamente los niveles de NtcA en las diferentes fases de desarrollo del heterocisto y constituye un punto clave de conexión entre la homeostasis del hierro y el metabolismo del nitrógeno en cianobacterias. Con la identificación de un gran número de nuevas dianas directas de FurA durante el transcurso de esta tesis fue posible además, mediante análisis in silico de varias secuencias protegidas por FurA en ensayos de footprinting, la definición de una posible secuencia regulatoria consenso de 23 pb (TGATAAAAATTCTCAATAAATAA), que gobierna potencialmente la unión del metalorregulador a sus promotores diana. En esta secuencia consenso fueron reconocidos al menos tres motivos de unión a proteínas Fur de 8 pb en disposición ¿head-to-head-to-tail¿. De modo general, los resultados del presente trabajo de tesis en su conjunto demuestran el papel de FurA como regulador global de la transcripción en cianobacterias, controlando mediante diferentes mecanismos de regulación no sólo la expresión de los genes implicados en el metabolismo del hierro, sino además la de una variedad de genes y operones implicados en múltiples funciones celulares, algunas de las cuales no descritas con anterioridad en bacterias heterotróficas. Los resultados obtenidos constituyen un importante aporte al conocimiento del papel de las proteínas Fur en la fisiología de las cianobacterias.

Pal. clave: bioquímica ; bioquímica molecular ; genética bioquímica

Knowledge area: Bioquímica y biología molecular

Department: Bioquímica y Biología Molecular y Celular

Nota: Presentado: 06 02 2013
Nota: Tesis-Univ. Zaragoza, Bioquímica y Biología Molecular y Celular, 2013

Creative Commons License

 Record created 2014-11-20, last modified 2019-02-19

Download fulltext

Rate this document:

Rate this document:
(Not yet reviewed)